Eine Demo buchen

Hyperoxaluria drug pipeline: RNAi and gene therapy

Hyperoxaluria Drug Pipeline: RNAi, Gene Therapy & Substrate Reduction — PatSnap Insights
Drug Pipeline Intelligence

The 2020 approval of lumasiran validated RNAi as a modality in primary hyperoxaluria—but the pipeline has since diversified dramatically. LDHA, the terminal oxalate-synthesizing enzyme, is now targeted by at least three distinct modalities from multiple organizations, while RNAi intellectual property is expanding from ultra-rare PH subtypes into secondary hyperoxaluria and dialysis-related cardiovascular disease.

PatSnap Insights Team Innovation Intelligence Analysts 11 min read
Teilen
Reviewed by the PatSnap Insights editorial team ·

Three diseases, one critical enzyme: the glyoxylate pathway as a drug target

Primary hyperoxaluria (PH) comprises three molecularly distinct autosomal recessive disorders of hepatic glyoxylate metabolism, all converging on a single enzymatic bottleneck. PH1—caused by mutations in AGXT encoding alanine-glyoxylate aminotransferase—accounts for approximately 80% of PH diagnoses. PH2 arises from deficiency in glyoxylate reductase/hydroxypyruvate reductase (GRHPR), and PH3 from deficiency of mitochondrial 4-hydroxy-2-oxoglutarate aldolase (HOGA1). All three subtypes converge on a final common pathway: lactate dehydrogenase A (LDHA) catalyzes the terminal and rate-limiting conversion of glyoxylate to oxalate in the liver.

~80%
of PH diagnoses are PH1 (AGXT mutation)
3
distinct PH subtypes, all targeted by LDHA inhibition
12×
elevated plasma glycolate in human HAO1 knockout — no adverse effects
1 in 30M
estimated frequency of natural HAO1 complete-knockout individuals

This convergence makes LDHA the most strategically important emerging target in the hyperoxaluria pipeline. Unlike lumasiran—which targets glycolate oxidase (HAO1) upstream of LDHA and is therefore restricted to PH1—any agent that suppresses LDHA activity has pan-PH applicability. Lumasiran’s 2020 approval demonstrated that hepatic RNAi is a viable modality in this disease area; the subsequent pipeline has largely organized itself around the question of whether LDHA inhibition can extend those benefits to all three subtypes and, increasingly, to secondary hyperoxaluria arising from metabolic conditions such as diabetes, inflammatory bowel disease, and bariatric surgery.

Four molecular targets are actively pursued across the retrieved dataset: HAO1 (the lumasiran target, now extended to non-PH indications), LDHA (the pan-PH target), PRODH2/proline dehydrogenase 2 (identified in Alnylam patent filings for non-PH oxalate disorders), and the NLRP3/NALP3 inflammasome (a downstream renal inflammatory target identified by researchers at Yale University as a principal driver of progressive renal failure in oxalate nephropathy).

What is LDHA and why does it matter for all PH subtypes?

Lactate dehydrogenase A (LDHA) catalyzes the sole committed step in hepatic oxalate synthesis—the conversion of glyoxylate to oxalate. Because this step is common to all three forms of primary hyperoxaluria regardless of which upstream enzyme is deficient, inhibiting LDHA reduces oxalate overproduction across PH1, PH2, and PH3. This pan-subtype applicability is the key commercial differentiator over lumasiran’s PH1-restricted mechanism via HAO1.

Primary hyperoxaluria type 1 (PH1), caused by mutations in the AGXT gene encoding alanine-glyoxylate aminotransferase, accounts for approximately 80% of primary hyperoxaluria diagnoses. All three PH subtypes (PH1, PH2, PH3) converge on LDHA-catalyzed oxalate synthesis, making LDHA a pan-PH therapeutic target.

Figure 1 — Hyperoxaluria drug pipeline: therapeutic modalities by development stage
Hyperoxaluria drug pipeline modalities by development stage Vorklinisch Phase I Phase II/III Phase II Nedosiran (RNAi/LDHA) Phase III O. formigenes (Microbiome) Vorklinisch CRISPR-Cas9 (AAV8/LDHA) Vorklinisch CHK-336 (SM/LDHA) Vorklinisch HYP Analogs (Substrate Red.) RNAi Microbiome Gene Editing Small Molecule Substrate Reduction
Nedosiran (RNAi/LDHA) and Oxalobacter formigenes (microbiome) have reached Phase II/III and Phase III respectively; CRISPR-Cas9, CHK-336, and hydroxy-L-proline analogs remain at preclinical stage based on retrieved evidence.

The RNAi landscape beyond lumasiran: nedosiran, combination strategies, and expanded indications

Nedosiran is the most clinically advanced non-lumasiran pipeline asset in the retrieved dataset. Developed by Dicerna Pharmaceuticals (now acquired by Novo Nordisk) and studied extensively at the German Hyperoxaluria Center Cologne/Bonn, nedosiran targets hepatic LDHA via RNAi, providing a rationale for efficacy across PH1, PH2, and PH3 regardless of which upstream enzymatic defect is present. Nonclinical data in mice and non-human primates demonstrated that hepatic LDHA inhibition reduces urinary oxalate excretion with liver-specific effects and no detectable impact on muscle LDHA—a critical safety concern given LDHA’s central role in anaerobic glycolysis. Phase I single-dose data (NCT03847909) confirmed hepatic specificity without off-target muscle effects in humans, and nedosiran has since entered Phase II trials.

Nedosiran is an RNAi therapeutic targeting hepatic LDHA (lactate dehydrogenase A) developed by Dicerna Pharmaceuticals (acquired by Novo Nordisk) for PH1, PH2, and PH3. Nonclinical and Phase I data confirmed liver-specific LDHA inhibition with no detectable impact on muscle LDHA. Nedosiran has entered Phase II clinical trials (NCT03847909).

Novo Nordisk Health Care AG holds an active JP patent (2025) covering specific LDHA-targeting oligonucleotide sequences, including the antisense strand sequence UCAGAUAAAAAGGACAACAUGG (SEQ ID NO:1), reflecting active IP protection of this approach. Alnylam Pharmaceuticals, the dominant RNAi IP holder for lumasiran, has simultaneously filed patents in WO and JP jurisdictions (2023–2024) extending nucleic acid inhibitor coverage for LDHA, HAO1, and a third target—PRODH2 (proline dehydrogenase 2)—to non-primary hyperoxaluria conditions. These filings explicitly cover patients with diabetes, Crohn’s disease, bariatric surgery sequelae, and other metabolic conditions in which calcium oxalate crystal deposition occurs despite normal primary oxalate metabolism, signalling a strategic shift from ultra-rare to broader metabolic indications.

“Alnylam’s 2023–2024 patent filings explicitly extend LDHA, HAO1, and PRODH2 targeting to secondary hyperoxaluria arising from metabolic conditions—potentially opening a substantially larger patient population than the rare PH diseases.”

A third RNAi strategy has emerged from an academic IP source. Charité – Universitätsmedizin Berlin has filed patents in WO, EP, and US jurisdictions covering a combination of lumasiran and nedosiran as a single therapeutic composition for dialysis patients who do not have primary hyperoxaluria. The clinical rationale is that uremic patients on maintenance dialysis accumulate oxalate, contributing to cardiovascular events and sudden cardiac death. Blocking both the upstream substrate supply (HAO1/glycolate oxidase) and the terminal conversion step (LDHA) simultaneously may achieve additive or synergistic oxalate reduction in this population. No clinical trial data for this combination approach were identified in the retrieved dataset, but the multi-jurisdictional patent filing signals early-mover IP activity in a novel oxalate-cardiovascular indication with a substantially larger addressable population than PH.

Track nedosiran patent filings, clinical trial status, and competitor RNAi IP in real time with PatSnap Eureka.

Explore the RNAi Pipeline in PatSnap Eureka →

HAO1 genetic validation: the human knockout precedent

The human genetic evidence underpinning HAO1 as a drug target is unusually robust. Collaborative work between Bristol Medical School and Alnylam Pharmaceuticals characterized a naturally occurring HAO1 complete-knockout individual—estimated to occur at a frequency of approximately 1 in 30 million—who showed 12-fold elevated plasma glycolate but no adverse systemic consequences. This directly informed the therapeutic rationale for deep and durable HAO1 silencing and established a precedent for using human natural history data to de-risk RNAi target selection. According to WIPO patent databases, HAO1-targeting oligonucleotide IP remains active across multiple jurisdictions. The retrieved dataset notes that similar human genetic validation studies for hepatic LDHA would significantly de-risk the nedosiran and CHK-336 development paths.

Figure 2 — Key molecular targets in the hyperoxaluria pipeline: modalities per target
Number of distinct therapeutic modalities targeting LDHA, HAO1, PRODH2, and NLRP3 in the hyperoxaluria drug pipeline 0 1 2 3 LDHA (pan-PH target) 2 HAO1 (PH1 + non-PH) 1 PRODH2 (non-PH only) 1 NLRP3 (renal adjunct) 3
LDHA is targeted by three distinct modalities (RNAi/nedosiran, CRISPR-Cas9/AAV8, small molecule/CHK-336), making it the central competitive target in the hyperoxaluria pipeline. HAO1 is addressed by two modalities; PRODH2 and NLRP3 each by one.

CRISPR gene editing and small-molecule inhibitors: one-shot durability versus chronic dosing

CRISPR-Cas9 gene therapy for primary hyperoxaluria is currently at the preclinical stage but offers a mechanistically distinct proposition: a single administration rather than the chronic subcutaneous dosing regimen required by approved RNAi agents. Research from the Instituto de Investigación Sanitaria de Navarra (IdiSNA) demonstrated that a single dose of AAV8-delivered CRISPR-Cas9 targeting hepatic LDH reduced urine oxalate and kidney damage in mouse models of both PH1 and PH3. The authors reference prior work establishing CRISPR-based glycolate oxidase inhibition as a PH1-specific strategy, positioning the LDHA-targeting CRISPR approach as a broader-coverage alternative. No IND filings, Phase I safety data, or human trial references were identified for CRISPR approaches in the retrieved dataset; organ-targeted delivery efficiency and immunogenicity of viral vectors remain key technical barriers.

Researchers at the Instituto de Investigación Sanitaria de Navarra demonstrated that a single dose of AAV8-delivered CRISPR-Cas9 targeting hepatic LDH reduced urine oxalate and kidney damage in mouse models of both PH1 and PH3 primary hyperoxaluria. This approach remains at preclinical stage with no clinical translation data reported as of 2025.

On the small-molecule front, CHK-336—described by Chinook Therapeutics (Vancouver, Canada) as a first-in-class, liver-targeted, potent, highly selective small-molecule LDH inhibitor—effectively lowers urinary oxalate in a mouse PH1 model with a favorable preclinical pharmacokinetic and safety profile. CHK-336 targets the same LDHA enzyme as nedosiran but employs a small-molecule rather than oligonucleotide modality, which may offer advantages in oral bioavailability and manufacturing scalability. Stanford ChEM-H researchers have also provided a broader systematic analysis of small-molecule enzyme inhibitors across all PH subtypes, covering multiple glyoxylate pathway enzymes. Both CHK-336 and the Stanford-reviewed compounds are at apparent early preclinical or IND-enabling stages based on retrieved evidence.

Key finding: three modalities, one target

LDHA is targeted by at least three distinct intervention strategies in the retrieved dataset: RNAi (nedosiran, Novo Nordisk/Dicerna Pharmaceuticals), CRISPR-Cas9 delivered via AAV8 vectors (IdiSNA), and small-molecule inhibition (CHK-336, Chinook Therapeutics). Each modality offers a different durability and delivery profile, but all share the pan-PH applicability rationale.

The competitive dynamic between RNAi and CRISPR for LDHA inhibition mirrors broader industry debates about chronic dosing versus one-shot gene editing. According to patent databases maintained by the European Patent Office, nucleic acid therapeutic filings in rare metabolic diseases have grown substantially since 2019, with LDHA-targeting sequences now subject to active IP protection by Novo Nordisk Health Care AG. The CRISPR approach, if it advances clinically, would compete on the basis of durability and potentially lower long-term cost of goods, while small molecules such as CHK-336 could offer advantages in patient convenience and manufacturing.

Microbiome therapy and substrate reduction: complementary mechanisms at the gut level

Oxalobacter formigenes (Oxabact™, OxThera AB, Stockholm) is an oxalate-metabolizing gut bacterium proposed to mediate active oxalate elimination from plasma to intestine, operating through a mechanism entirely distinct from hepatic substrate reduction. Two registered clinical trials at Phase II/III and Phase III level were identified in the retrieved dataset: a randomized, double-blind, placebo-controlled Phase II/III study conducted at the Academic Medical Center, University of Amsterdam, evaluating Oxabact™ OC3 over 24 weeks in PH patients; and the ePHex Phase III trial at the Royal Free Hospital, London, evaluating Oxabact™ in PH patients with maintained but suboptimal kidney function (mean eGFR less than 90 mL/min/1.73 m²). Primary endpoint outcomes from these trials were not available in the retrieved dataset.

A single-patient case report from the Department of Ophthalmology, University of Bonn documents that O. formigenes combined with intensive dialysis lowered plasma oxalate and halted disease progression in a severely affected infant with PH1, suggesting potential utility even in advanced disease states when combined with other interventions. Retrieved review literature discusses the potential for combining substrate reduction agents (RNAi targeting hepatic oxalate synthesis) with gut-level oxalate disposal (microbiome therapy) as complementary mechanisms addressing both hepatic production and intestinal absorption and excretion.

Map the full competitive landscape for hyperoxaluria therapeutics—from patent filings to clinical trial data—in PatSnap Eureka.

Analyse Hyperoxaluria Patents in PatSnap Eureka →

Substrate reduction via hydroxy-L-proline analogs

A further substrate reduction strategy—distinct from direct enzyme inhibition—involves hydroxy-L-proline (HYP) analogs. HYP is a dietary precursor contributing to hepatic glyoxylate and oxalate production; analogs designed to inhibit its catabolism represent an alternative approach to reducing substrate availability for LDHA. Researchers at Tongji Hospital, Huazhong University of Science and Technology evaluated HYP analogs in a Drosophila melanogaster PH model. This remains at a preclinical invertebrate-model stage with no mammalian or clinical data in the retrieved dataset.

NLRP3 inflammasome inhibition as a renal-protective adjunct

Researchers at Yale University School of Medicine have identified NALP3-mediated renal inflammation as a principal driver of progressive renal failure in oxalate nephropathy. Beta-hydroxybutyrate (BHB) is noted in the dataset as an NLRP3 inhibitor with a preclinical signal in hyperoxaluria-related kidney stone disease. This anti-inflammatory approach is positioned as a complementary strategy to oxalate-reducing agents rather than a standalone therapy, addressing the downstream renal injury that accumulates even when oxalate production is partially controlled. Data on NLRP3 inhibition in this context are referenced by researchers publishing in journals indexed by NIH/PubMed.

Competitive implications: IP whitespace, genetic validation, and the LDHA battleground

LDHA is the central competitive battlefield in the hyperoxaluria pipeline. At least three distinct modalities from multiple organizations converge on this single enzyme, with pan-PH applicability as the key commercial differentiator over lumasiran’s PH1-restricted mechanism. The retrieved patent data from Novo Nordisk Health Care AG protect specific oligonucleotide sequences targeting LDHA, while Alnylam’s filings extend nucleic acid inhibitor coverage to non-PH indications. Competitors entering the LDHA space will face established IP from both Novo Nordisk/Dicerna and, increasingly, from Alnylam’s broader indication claims.

Alnylam Pharmaceuticals filed patents in WO and JP jurisdictions in 2023–2024 extending RNAi targeting of LDHA, HAO1, and PRODH2 to non-primary hyperoxaluria conditions including patients with diabetes, Crohn’s disease, and bariatric surgery sequelae—representing a strategic expansion from ultra-rare PH indications to broader metabolic disease populations.

IP whitespace exists in non-PH oxalate-related disorders. Alnylam and Charité filings signal early-mover activity in secondary hyperoxaluria and oxalate-driven cardiovascular disease in dialysis patients—conditions with substantially larger addressable populations than the three primary hyperoxaluria subtypes combined. Organizations entering these indications will encounter established nucleic acid inhibitor IP from Alnylam and potential exclusivity arguments from Charité’s combination therapy claims covering the lumasiran-plus-nedosiran composition.

The precedent set by human HAO1 knockout characterization—demonstrating that complete enzyme loss is benign—represents a model for de-risking future RNAi target selection. Similar human genetic validation for hepatic LDHA loss-of-function would significantly strengthen the safety argument for deep and durable LDHA silencing by nedosiran or CHK-336. Patent landscape analysis tools such as those offered by PatSnap Eureka can accelerate identification of such genetic evidence in the published literature. The PatSnap platform aggregates over 2 billion data points from 120+ countries, enabling systematic IP and literature surveillance across the hyperoxaluria competitive space.

“The clinical positioning of Oxalobacter formigenes relative to RNAi agents—particularly in patients with advanced renal impairment—remains an open strategic question, as primary endpoint outcomes from the ePHex Phase III trial were not available in the retrieved dataset.”

For CRISPR and small-molecule approaches, the absence of any clinical translation signal in the retrieved dataset suggests both remain at early stages. CRISPR/AAV8 approaches face manufacturing and re-dosing challenges alongside immunogenicity concerns for viral vectors—barriers not addressed in the retrieved preclinical results. Small molecules such as CHK-336 may offer a more tractable development path, but will need to demonstrate selectivity for hepatic LDHA over systemic LDHA to address the muscle safety concern that was a primary focus of the nedosiran nonclinical program. As documented by patent offices including the USPTO, the competitive IP landscape in rare metabolic disease RNAi continues to evolve rapidly, making continuous patent surveillance a strategic necessity for any organization active in this space.

Häufig gestellte Fragen

Hyperoxaluria drug pipeline — key questions answered

Still have questions? Let PatSnap Eureka answer them for you.

Ask PatSnap Eureka for a Deeper Answer →

Referenzen

  1. Lumasiran: expanding the treatment options for patients with primary hyperoxaluria type 1 — Department of Nephrology, Birmingham Women’s and Children’s Hospital NHS Foundation Trust, UK (2021)
  2. Hepatic Lactate Dehydrogenase A: An RNA Interference Target for the Treatment of All Known Types of Primary Hyperoxaluria — German Hyperoxaluria Center Cologne/Bonn (2021)
  3. Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder — Alnylam Pharmaceuticals, Inc. (2023, WO)
  4. Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluric disease or disorder — Alnylam Pharmaceuticals, Inc. (2024, JP)
  5. Methods and compositions for inhibiting expression of LDHA — Novo Nordisk Health Care AG (2025, JP)
  6. Composition and method for reducing oxalate levels in patients receiving maintenance dialysis — Charité – Universitätsmedizin Berlin (2022, WO)
  7. Composition and method for reducing oxalate levels in patients receiving maintenance dialysis — Charité – Universitätsmedizin Berlin (2022, EP)
  8. Composition and method for reducing oxalate levels in patients receiving maintenance dialysis — Charité – Universitätsmedizin Berlin (2024, US)
  9. In vivo CRISPR-Cas9 inhibition of hepatic LDH as treatment of primary hyperoxaluria — Instituto de Investigación Sanitaria de Navarra (IdiSNA) (2022)
  10. Small Molecule-Based Enzyme Inhibitors in the Treatment of Primary Hyperoxalurias — Stanford ChEM-H, Stanford University (2021)
  11. POS-442 Discovery of CHK-336: A First-in-Class, Liver-Targeted, Small Molecule Inhibitor of Lactate Dehydrogenase for the Treatment of Primary Hyperoxaluria — Chinook Therapeutics, Vancouver, Canada (2021)
  12. A randomised Phase II/III study to evaluate the efficacy and safety of orally administered Oxalobacter formigenes to treat primary hyperoxaluria — Academic Medical Center, University of Amsterdam (2017)
  13. ePHex: a phase 3, double-blind, placebo-controlled, randomized study to evaluate long-term efficacy and safety of Oxalobacter formigenes in patients with primary hyperoxaluria — Royal Free Hospital, London (2022)
  14. Oxalobacter formigenes treatment combined with intensive dialysis lowers plasma oxalate and halts disease progression in a patient with severe infantile oxalosis — Department of Ophthalmology, University of Bonn (2020)
  15. Characterising a healthy adult with a rare HAO1 knockout to support a therapeutic strategy for primary hyperoxaluria — Population Health Science, Bristol Medical School (2020)
  16. Deep phenotyping of a healthy human HAO1 knockout informs therapeutic development for primary hyperoxaluria type 1 — Alnylam Pharmaceuticals, Cambridge MA (2019)
  17. Primary hyperoxaluria type 1: novel therapies at a glance — CHU de Lyon, France (2022)
  18. Therapeutic RNA interference: A novel approach to the treatment of primary hyperoxaluria — University of Melbourne (2021)
  19. NALP3-mediated inflammation is a principal cause of progressive renal failure in oxalate nephropathy — Department of Internal Medicine, Yale University School of Medicine (2013)
  20. Efficacy of Hydroxy-L-proline (HYP) analogs in the treatment of primary hyperoxaluria in Drosophila Melanogaster — Tongji Hospital, Huazhong University of Science and Technology (2018)
  21. WIPO — World Intellectual Property Organization: global patent database and nucleic acid therapeutic filings
  22. European Patent Office — patent landscape for rare metabolic disease RNAi therapeutics
  23. USPTO — United States Patent and Trademark Office: LDHA and HAO1 oligonucleotide patent filings

All data and statistics in this article are sourced from the references above and from PatSnap‘s proprietary innovation intelligence platform. This article is derived from a limited set of patent and literature records retrieved across targeted searches and represents a snapshot of innovation signals within that dataset only; it should not be interpreted as a comprehensive view of the full clinical pipeline or regulatory landscape.

Ihr Partner für künstliche Intelligenz
für intelligentere Innovationen

PatSnap fuses the world’s largest proprietary innovation dataset with cutting-edge AI to
supercharge R&D, IP strategy, materials science, and drug discovery.

Eine Demo buchen