Réserver une démonstration

RNA-targeting therapies in ALS: ASOs, RNAi & combos

RNA-Targeting Therapies in ALS: ASOs, Small Molecules & Combinations — PatSnap Insights
Drug Discovery Intelligence

ALS remains without a cure, yet a convergence of antisense oligonucleotides, RNA interference, small molecule RNA binders, and gene therapy is producing a wave of patent activity targeting the disease’s RNA-processing core — from SOD1 suppression to C9orf72 repeat degradation and TDP-43 downstream rescue.

PatSnap Insights Team Innovation Intelligence Analysts 11 min read
Partager
Reviewed by the PatSnap Insights editorial team ·

ALS as an RNA disease: the genetic and molecular targets

Amyotrophic lateral sclerosis is fundamentally a disease of RNA metabolism. Approximately 90% of cases are sporadic and approximately 10% are familial, with familial forms linked to mutations in SOD1, C9orf72, TARDBP (encoding TDP-43), FUS, and other genes — each of which disrupts RNA processing in motor neurons through distinct but overlapping mechanisms. No curative therapy currently exists, and this molecular complexity has made RNA itself the primary therapeutic target across multiple modalities.

~90%
Sporadic ALS cases
~10%
Familial ALS cases
20–30%
Familial ALS linked to SOD1 mutations
50 nM
Effective RIBOTAC dose in c9ALS iPSC neurons

The C9orf72 hexanucleotide repeat expansion (G4C2) produces toxic RNA that sequesters RNA-binding proteins and also drives dipeptide repeat protein (DPR) toxicity through repeat-associated non-AUG translation. TDP-43 loss-of-function causes aberrant cryptic exon inclusion in the transcripts of STMN2 — a gene required for axonal regeneration — and UNC13A, a synaptic vesicle protein. FUS and TDP-43 aggregation, driven by low-complexity domain misfolding, further disrupts RNA metabolism at the cellular level. ADAR2-dependent A-to-I RNA editing deficiency has additionally been identified as a molecular feature of motor neuron degeneration, flagged as both a diagnostic and mechanistic biomarker by researchers at the University of Tokyo.

In ALS, C9orf72 hexanucleotide repeat expansion (G4C2) transcribes toxic RNA that sequesters RNA-binding proteins, while TDP-43 loss-of-function causes cryptic exon inclusion in both STMN2 and UNC13A transcripts — pathologies present across the vast majority of ALS patients regardless of causative mutation.

This convergence of RNA pathologies across genetically distinct ALS subtypes is what makes RNA-targeting strategies so compelling: a single splice-switching ASO correcting STMN2 or UNC13A mis-splicing could theoretically benefit the majority of patients, not just those with a specific familial mutation. According to WHO disease burden data and research published by Nature, neurodegenerative diseases represent a growing global health challenge with significant unmet therapeutic need.

What is ADAR2-dependent RNA editing?

ADAR2 is an enzyme that performs adenosine-to-inosine (A-to-I) editing of RNA transcripts. In ALS motor neurons, ADAR2 activity is deficient, altering the editing of specific RNA sites. A patent from the National University Corporation University of Tokyo describes a method of diagnosing ALS pathology via identification of these ADAR2-dependent RNA editing sites, suggesting impaired RNA editing as a molecular hallmark of motor neuron degeneration.

Antisense oligonucleotides: the dominant modality and clinical frontier

Antisense oligonucleotides constitute the most heavily represented modality in the ALS RNA-targeting patent landscape, appearing across at least a dozen retrieved patent records. ASOs work either through RNase H-mediated degradation of target pre-mRNA or mRNA (gapmer design) or through splice-switching to restore correct transcript isoforms — a distinction that is critical for understanding which ALS targets each approach is suited to.

Figure 1 — ASO targets in ALS RNA-targeting therapy: patent representation by gene target
Antisense oligonucleotide gene targets in ALS RNA-targeting therapy by patent representation 0 1 2 3 4 Patent records (approx.) 4 SOD1 3 C9orf72 2 STMN2 2 UNC13A 1 Calpain-2 Gene target
SOD1 is the most heavily targeted gene for ASO therapies in this dataset, addressed by Biogen, Black Swan Pharmaceuticals, and others; STMN2 and UNC13A represent the emerging TDP-43 downstream splice-switching cluster led by Claris Corporation.

SOD1-targeting ASOs are the most clinically advanced. Biogen MA Inc. has filed dosing guidelines for the compound known as BIIB067/IONIS-SOD1Rx (tofersen), an intrathecal ASO that completed a Phase 3 trial confirming tolerability and showing favorable biomarker and clinical trends, though it did not meet its primary efficacy endpoint. Black Swan Pharmaceuticals has separately claimed ASOs complementary to SOD1 pre-mRNA, asserting that reduced SOD1 expression is beneficial in ALS.

Tofersen (BIIB067/IONIS-SOD1Rx), a SOD1-targeting intrathecal antisense oligonucleotide developed by Biogen MA Inc., completed a Phase 3 clinical trial for ALS that confirmed tolerability and showed favorable biomarker trends but did not meet its primary efficacy endpoint.

Splice-switching ASOs for STMN2 and UNC13A represent the most translationally significant innovation for sporadic ALS in this dataset. Claris Corporation (formerly QurAlis) has disclosed two related programs: ASOs that reduce cryptic exon inclusion in TDP-43-loss-of-function conditions to restore full-length STMN2 transcript, and ASOs targeting mis-spliced UNC13A transcripts associated with TDP-43 pathology. Modified backbone chemistries — including phosphorothioate, phosphorodiamidate, and alkylphosphonate linkages — are emphasized to improve CNS stability and activity. Because TDP-43 pathology affects the vast majority of ALS patients regardless of causative mutation, these splice-switching programs could address a far broader patient population than SOD1-specific therapies.

Calpain-2 targeting ASOs from Amylyx Pharmaceuticals represent a novel target beyond the canonical SOD1/C9orf72/TDP-43 axis. Their filing specifies a defined ASO sequence (SEQ ID NO:1, ATCAGTTTCTGTAGGCTTCC) employing 2′-O-methoxyethylribose-modified terminal nucleosides and phosphorothioate backbone linkages, with method claims including reducing deterioration of, maintaining, or improving muscle strength in ALS subjects.

Explore the full ASO patent landscape for ALS targets in PatSnap Eureka — including sequence-level data and assignee mapping.

Explore ASO Patent Data in PatSnap Eureka →

RNAi, miRNA modulation, and the AAV delivery layer

RNA interference delivered via recombinant adeno-associated virus (rAAV) vectors constitutes the second major modality cluster in this dataset, leveraging AAV capsid tropism for motor neurons and the potential for long-term transgene expression from a single administration. The dominant application is SOD1 suppression, but C9orf72 and pan-aggregation targets are also represented.

AAV-delivered RNAi for SOD1 and C9orf72

Voyager Therapeutics has disclosed AAV vectors encoding siRNA targeting SOD1 mRNA, with antisense strands of 17–22 nucleotides. Biogen MA Inc. has taken a complementary approach, disclosing rAAV vectors carrying one or more artificial miRNAs (amiRs) targeting SOD1, including constructs with at least two miRNAs, with wild-type miRNA scaffold modifications to optimize potency and tolerability. The University of Missouri curators have disclosed SOD1-targeting AAV polynucleotides encompassing siRNA duplexes, shRNAs, miRNAs, and miRNA precursors, applicable to both ALS and canine degenerative myelopathy. University of Massachusetts has separately covered C9orf72 repeat expansion suppression via rAAV-delivered miRNA constructs targeting both pre-mRNA and mRNA.

“Splice-switching ASOs for TDP-43 downstream targets STMN2 and UNC13A represent the most translationally proximal RNA-targeting innovation for sporadic ALS, given that TDP-43 pathology affects the vast majority of ALS patients regardless of causative mutation.”

miRNA modulation: inhibitors, mimics, and Dicer enhancement

Several retrieved results address miRNA as both therapeutic target and diagnostic biomarker. miR-155 inhibition is the most clinically advanced miRNA approach in this dataset: MiRagen Therapeutics has disclosed oligonucleotide inhibitors of miR-155 (11–16 nucleotide anti-miRs) that reduce neuroinflammation in ALS, based on the clinical observation that miR-155 is upregulated in spinal cord and peripheral monocytes of both sporadic and familial ALS patients.

miR-17~92 cluster restoration has been proposed by Academia Sinica (Taiwan) as a therapeutic target, noting that mir-17~92 expression in spinal motor neurons declines specifically before motor neuron loss onset in SOD1G93A mice, suggesting a protective role. miR-485 inhibition is disclosed by BioOrchestra Co., Ltd. as a strategy to rescue SIRT1, PGC-1α, STMN2, and NRXN1 levels, providing neuroprotection through multiple downstream pathways.

A particularly innovative approach comes from Yeda Research and Development Company Limited (Weizmann Institute): quinolone antibiotics such as enoxacin and ciprofloxacin act as cytoplasmic pre-miRNA processing enhancers — Dicer activators — proposed as combination partners with riluzole in ALS. This represents a small molecule strategy to enhance the global miRNA biogenesis machinery rather than targeting a single miRNA species. The Brigham and Women’s Hospital has additionally identified a panel of miRNAs (including hsa-miR-155, hsa-miR-206, and hsa-miR-21) from CD14+CD16− monocytes as diagnostic and therapeutic response biomarkers in ALS, according to data published by institutions including NIH-affiliated researchers.

Key finding: RACK1 as a pan-aggregation target

The University of British Columbia has disclosed RACK1 knockdown via ASO/siRNA/shRNA as a strategy to suppress both TDP-43 and FUS aggregation simultaneously. Because TDP-43 and FUS pathology are shared across ALS, FTLD, and related disorders, RACK1 represents a convergent intervention point applicable across multiple ALS genotypes — a single target addressing two of the disease’s most prevalent protein aggregation pathologies.

Figure 2 — RNA-targeting modalities in ALS: development stage distribution across patent dataset
Development stage distribution of RNA-targeting ALS therapy modalities including ASOs, RNAi, miRNA, and small molecules ASOs (SOD1) Splice-switch ASOs AAV-RNAi miRNA modulators RIBOTAC small mol. Préclinique Phase 1/2 Phase 3 Approved/Post-P3 Phase 3 (tofersen) Translational Préclinique Early clinical (miR-155) iPSC validation
SOD1-targeting ASOs (tofersen) are the most clinically advanced; splice-switching ASOs for STMN2/UNC13A are approaching translational readiness; RNAi/AAV and RIBOTAC small molecules remain at preclinical or iPSC validation stages based on retrieved patent data.

Small molecule RNA binders: the RIBOTAC approach to C9orf72

A structurally distinct and emerging cluster in the ALS RNA-targeting landscape involves small molecules designed to directly bind disease-relevant RNA structures — particularly the C9orf72 G4C2 repeat expansion — and trigger their catalytic degradation. This approach, pioneered by the University of Florida Research Foundation, represents the most conceptually novel RNA-targeting strategy in this dataset.

The University of Florida Research Foundation has disclosed pyridocarbazole-based RIBOTAC (RNA-targeting chimera) compounds that bind the C9orf72 G4C2 repeat expansion RNA and recruit RNase L for catalytic degradation, demonstrating significant reduction of repeat-containing transcripts in iPSC-derived neurons from c9ALS/FTD patients at 50 nM, with transcriptome-wide minimal off-target effects and greater selectivity than a comparator ASO targeting the same repeat.

The RIBOTAC strategy is bifunctional: one moiety of the molecule provides structure-selective recognition of the r(G4C2)exp RNA hairpin; the other, connected via a PEG linker, recruits RNase L to catalytically degrade the bound transcript. This is conceptually analogous to the PROTAC approach for protein degradation, but applied to RNA. In iPSC-derived neurons from c9ALS/FTD patients, the lead pyridocarbazole compound (formula I) at 50 nM significantly reduced the intron 1:exon 2 ratio — a proxy for repeat-containing transcripts — without affecting total C9orf72 read-out counts. Transcriptome-wide analysis showed minimal off-target effects, and the compound showed greater selectivity for the RNA structure than a comparator ASO targeting the same repeat.

The significance of this selectivity data should not be understated. The C9orf72 G4C2 repeat expansion forms stable hairpin and G-quadruplex structures that are structurally distinct from the surrounding genomic sequence — structures that small molecules can exploit for selectivity in ways that sequence-complementary ASOs cannot. This positions small molecule RIBOTACs and ASOs as potentially complementary rather than competitive approaches for C9orf72 RNA pathology, a point explicitly noted in the University of Florida data. The broader RNA-targeting field has been tracked by organizations including WIPO, which has documented rapid growth in oligonucleotide and RNA medicine patent filings globally.

Track the emerging RIBOTAC and small molecule RNA binder patent space with PatSnap Eureka’s AI-powered analysis tools.

Analyse RNA-Targeting Patents in PatSnap Eureka →

Combination strategies and emerging multi-target directions

Combination and convergent strategies are an active area of innovation in ALS RNA-targeting therapy, with retrieved patent data revealing at least six distinct combination rationales spanning small molecule plus standard-of-care, multi-target viral vectors, and delivery-payload co-optimization.

Dicer activator combined with riluzole

Yeda Research and Development Company Limited (Weizmann Institute) explicitly proposes combining a pre-miRNA processing enhancer — specifically enoxacin, a quinolone antibiotic acting as a Dicer cofactor — with riluzole, the standard-of-care ALS agent. Pharmaceutical compositions and clinical study selection criteria are described. This represents a mechanistically grounded small molecule combination: riluzole reduces glutamate excitotoxicity while the Dicer activator enhances global miRNA biogenesis, addressing neuroinflammation and RNA processing dysfunction simultaneously.

Multi-target AAV vectors

Penn State Research Foundation and University of Massachusetts filings disclose AAV constructs encoding multiple effectors simultaneously — combinations of transcription factors (NeuroD1, Isl1) with miRNAs (mir124, mir218) for neuronal reprogramming, and constructs targeting both C9orf72 and SOD1 nucleic acids. This multiplexed payload approach reflects a recognition that ALS pathology is rarely driven by a single molecular insult, and that durable therapeutic benefit may require addressing multiple pathogenic nodes from a single vector administration.

Base editing and ASO precedent convergence

Beam Therapeutics has disclosed adenosine base editors targeting splice acceptor sites within the SOD1 gene to introduce a premature stop codon or disrupt normal splicing, reducing SOD1 expression. Combined with the established ASO-mediated SOD1 suppression precedent from Biogen and others, this signals that multiple levels of gene regulation — epigenomic, transcriptomic, and RNA-level — may be combined in future ALS strategies. CRISPR Therapeutics has separately disclosed genome-editing approaches to modulate C9orf72 expression via CRISPR-based methods.

CNS-targeted delivery conjugates

Dyne Therapeutics has filed on covalent conjugation of CNS-targeting moieties to oligonucleotide payloads, small molecules, and gene therapy vectors — a delivery optimization strategy that runs parallel to payload innovation. Improved CNS penetration and cell-type specificity could significantly enhance the therapeutic index of existing ASO and RNAi payloads without requiring new molecular targets.

Figure 3 — ALS RNA-targeting combination strategy landscape: modalities and rationale
Combination therapy strategies in RNA-targeting ALS therapies: Dicer activator plus riluzole, multi-target AAV, base editing plus ASO, and CNS delivery conjugates Dicer Activator + Riluzole Multi-target AAV SOD1+C9orf72 Base Edit + ASO SOD1 axis CNS Delivery Conjugates Yeda/Weizmann Penn State / UMass Beam Therapeutics Dyne Therapeutics
Four distinct combination rationales are active in the ALS RNA-targeting patent landscape: Dicer activator plus riluzole (Yeda), multi-target AAV vectors (Penn State/UMass), base editing plus ASO precedent (Beam Therapeutics), and CNS-targeted delivery conjugates (Dyne Therapeutics).

Who holds the IP: assignee landscape and strategic signals

Patent activity in ALS RNA-targeting therapy is distributed across large pharma/biotech actors, specialist RNA medicine companies, and academically-originating innovators — each occupying distinct modality niches with varying translational proximity.

Biogen MA Inc. holds IP across both SOD1-targeting ASO dosing guidelines (tofersen) and SOD1-targeting AAV-amiR constructs, representing the broadest clinical-stage RNA-targeting portfolio in this dataset for ALS. Claris Corporation / QurAlis Corporation is the most active recent filer for splice-switching ASOs, with multiple filings covering STMN2 and UNC13A programs with novel backbone chemistry — positioning the company as a potential near-term licensing or acquisition target given the breadth of TDP-43 downstream pathology it addresses. Voyager Therapeutics holds AAV-siRNA IP for SOD1 with defined antisense strand lengths of 17–22 nucleotides.

University of Florida Research Foundation holds the small molecule RIBOTAC IP for C9orf72, with filings in the US, Japan, and China — a geographically broad academic patent portfolio with commercial translation signals. Amylyx Pharmaceuticals brings a novel ASO target (calpain-2) with a defined sequence and modification chemistry, expanding the therapeutic target space beyond the canonical ALS gene set. Beam Therapeutics and CRISPR Therapeutics AG represent next-generation precision editing approaches at the SOD1 and C9orf72 loci respectively.

Academic institutions — Penn State Research Foundation, Columbia University, University of British Columbia, University of Massachusetts, Academia Sinica, and the Weizmann Institute (via Yeda Research) — collectively account for a substantial fraction of the innovation signals in this dataset, particularly for neuronal reprogramming, pan-aggregation targets, and Dicer enhancement strategies. This academic concentration suggests significant freedom-to-operate considerations and licensing opportunities for commercial partners. Patent data from EPO and global filings tracked via PatSnap’s platform confirms the multi-jurisdictional nature of these portfolios.

Claris Corporation (formerly QurAlis) holds multiple patents covering splice-switching antisense oligonucleotides targeting both STMN2 and UNC13A — downstream consequences of TDP-43 loss-of-function — using modified backbone chemistries including phosphorothioate, phosphorodiamidate, and alkylphosphonate linkages to improve CNS stability.

Kyoto University (National University Corporation) is active in small molecule kinase inhibitor screening using ALS patient iPSC-derived motor neurons, with a TDP-43-centric drug discovery focus. PIKfyve kinase inhibitors are referenced as having entered early clinical trials for ALS based on protein clearance mechanisms, providing context for the broader kinase-targeting landscape that complements RNA-level interventions. The Methodist Hospital has filed on serum immunology-based biomarkers for ALS therapy monitoring, and The Brigham and Women’s Hospital has covered miRNA profiling in monocytes and CSF for both diagnosis and therapeutic response assessment — a diagnostic infrastructure that will be essential for stratifying patients into the genotype-specific RNA-targeting trials now entering the clinic.

Questions fréquentes

RNA-targeting therapies in ALS — key questions answered

Still have questions? Let PatSnap Eureka answer them for you.

Ask PatSnap Eureka for a Deeper Answer →

Références

  1. Yale University (2025) — Methods of modifying neurons in vivo to treat and/or prevent amyotrophic lateral sclerosis (ALS) [Patent]
  2. University of Florida Research Foundation (2023) — Method for treating ALS/FTD through degradation of RNA repeat expansion [Patent]
  3. University of Florida Research Foundation (2024) — Small molecule degrading methods for treating ALS/FTD [Patent]
  4. Tsinghua University (2020) — TRIM72 as a potential therapeutic target for ALS through ubiquitination of FUS mutants [Patent]
  5. National University Corporation University of Tokyo (2021) — Biomarkers for ALS and methods for diagnosing ALS [Patent]
  6. Biogen MA Inc. (2021) — Compositions and methods for treating and preventing amyotrophic lateral sclerosis [Patent]
  7. Black Swan Pharmaceuticals, Inc. (2024) — Treatment for SOD1-related diseases [Patent]
  8. Claris Corporation (2023) — Treatment of neurological disorders using modulators of gene transcripts [Patent]
  9. Claris Corporation (2024) — Splice switcher antisense oligonucleotides with modified backbone chemistry [Patent]
  10. Claris Corporation (2024) — Treatment of neurological disorders using modulators of UNC13A gene transcripts [Patent]
  11. Amylyx Pharmaceuticals, Inc. (2026) — Antisense oligonucleotides targeting calpain-2 [Patent]
  12. University of Massachusetts (2017) — rAAV-based compositions and methods for treating amyotrophic lateral sclerosis [Patent]
  13. Voyager Therapeutics, Inc. (2021) — Compositions and methods of treating amyotrophic lateral sclerosis (ALS) [Patent]
  14. Biogen MA Inc. (2022) — Compositions and methods for treating amyotrophic lateral sclerosis (ALS) with AAV-mir-SOD1 [Patent]
  15. The Curators of the University of Missouri (2024) — Treatment of amyotrophic lateral sclerosis (ALS) [Patent]
  16. University of Massachusetts (2024) — rAAV-based composition and method for treating amyotrophic lateral sclerosis [Patent]
  17. The University of British Columbia (2023) — Compositions and methods for inhibiting TDP-43 and FUS aggregation [Patent]
  18. MiRagen Therapeutics, Inc. (2018) — A miR-155 inhibitor for the treatment of amyotrophic lateral sclerosis (ALS) [Patent]
  19. Academia Sinica (2019) — Mir-17~92 as therapeutic or diagnostic target of motor neuron (MN) degeneration diseases [Patent]
  20. BioOrchestra Co., Ltd. (2023) — Use of miRNA-485 inhibitors to treat amyotrophic lateral sclerosis (ALS) [Patent]
  21. Yeda Research and Development Company Limited (2018) — Methods of diagnosing and treating motor neuron disease [Patent]
  22. The Brigham and Women’s Hospital, Inc. (2020) — MicroRNAs in Neurodegenerative Disorders [Patent]
  23. The Penn State Research Foundation (2021) — Regenerating functional neurons for treatment of spinal cord injury and ALS [Patent]
  24. The Trustees of Columbia University in the City of New York (2024) — Compositions and methods of treatment for ALS using re-expression of embryonic motor neuron transcription factors [Patent]
  25. Beam Therapeutics Inc. (2025) — Using adenosine base editors to disrupt splice acceptor sites of disease-associated genes [Patent]
  26. CRISPR Therapeutics AG (2019) — Materials and methods for treating ALS and/or frontotemporal lobar degeneration [Patent]
  27. Dyne Therapeutics (2025) — CNS-targeting conjugates and uses thereof [Patent]
  28. Methodist Hospital (2024) — Serum immunology-based biomarkers for ALS therapy [Patent]
  29. WIPO — World Intellectual Property Organization: Global patent data and RNA medicine filing trends
  30. EPO — European Patent Office: ALS and oligonucleotide therapy patent database
  31. NIH — National Institutes of Health: ALS research and miRNA biomarker studies
  32. Nature — Peer-reviewed research on RNA medicine and neurodegenerative disease

All data and statistics in this article are sourced from the references above and from PatSnap‘s proprietary innovation intelligence platform. This article is derived from a targeted set of patent and literature records and represents a snapshot of innovation signals within this dataset only; it should not be interpreted as a comprehensive view of the full clinical pipeline or regulatory landscape.

Eureka built for innovation research

Eureka built for research
Domain-specific AI agents for IP, Engineering, Life Sciences, and Materials
Patents, Scientific Literature, Compounds & More Unified in One Platform
Ask, Research, Solve, Draft, and Validate Your Work from Weeks to Minutes
Try it for Free

Votre partenaire en IA agentique
pour une innovation plus intelligente

PatSnap fuses the world’s largest proprietary innovation dataset with cutting-edge AI to
supercharge R&D, IP strategy, materials science, and drug discovery.

Réserver une démonstration