Why Targeting AGT Upstream Matters for Resistant Hypertension
Angiotensinogen (AGT) is the sole precursor of the renin–angiotensin–aldosterone system (RAAS) and the only known substrate for renin — meaning that silencing AGT at the RNA level eliminates substrate availability for the entire cascade, a mechanism that no approved drug class, including ACE inhibitors, ARBs, or renin inhibitors, replicates. Multiple patent filings retrieved from across the AGT-silencing landscape explicitly define treatment-resistant hypertension (TRH) as the primary clinical indication: blood pressure remaining above goal (systolic >130 mmHg or diastolic >90 mmHg) despite simultaneous use of three antihypertensive agents of different classes, one of which is a thiazide diuretic, or controlled only with four or more agents.
The clinical rationale for an upstream, mechanism-novel approach is reinforced by the scale of the unmet need. Alnylam Pharmaceuticals’ EP-granted patent notes that over two-thirds of hypertensive subjects are not controlled with one antihypertensive agent and require two or more agents from different drug classes. AGT-associated disorders catalogued across patent filings extend well beyond hypertension itself, encompassing hypertensive nephropathy, chronic kidney disease, glomerulosclerosis, aortic aneurysm, atherosclerosis, heart failure, myocardial infarction, stroke, preeclampsia, eclampsia, and Cushing’s syndrome — a breadth of indication that underscores the RAAS cascade’s systemic reach.
Treatment-resistant hypertension is defined in AGT-silencing patent filings as blood pressure remaining above goal (systolic >130 mmHg or diastolic >90 mmHg) despite concurrent use of three antihypertensive agents of different classes including a thiazide diuretic, or controlled only with four or more agents.
AGT is a glycoprotein produced predominantly in the liver and is the obligate, sole precursor substrate for renin — the enzyme that initiates the RAAS cascade. Because every angiotensin peptide (I and II) derives from AGT cleavage, silencing hepatic AGT mRNA expression suppresses the entire downstream cascade at its source, unlike drugs that block individual enzymes or receptors within the pathway.
RNA Modalities in the AGT Patent Landscape: siRNA, ASO, and GalNAc Conjugates
Three distinct RNA-targeting modalities are represented in the AGT-silencing patent landscape: RNA interference (RNAi/siRNA), antisense oligonucleotides (ASO), and GalNAc-conjugated siRNA delivery systems — each with a different developer profile, stage of maturity, and differentiation thesis.
RNAi / siRNA: The Dominant Modality
Double-stranded RNA interference targeting AGT mRNA is the dominant modality in the retrieved dataset, with Alnylam Pharmaceuticals accounting for the majority of filings across at least 12 distinct jurisdictions. The specific antisense sequence disclosed in multiple filings is UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), with the corresponding sense strand GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10). These sequences are claimed in fixed-dose compositions ranging from 50 to 800 mg for subcutaneous or intravenous administration. The compound AD-85481 is referenced by name in the JP filing in the context of fixed-dose (~600 mg) subcutaneous administration combined with standard antihypertensives. According to NIH clinical trial registries cited in Alnylam patent background sections, the clinical rationale for this approach draws on published SPRINT and KDIGO study data establishing unmet need in blood pressure management and kidney protection.
Antisense Oligonucleotides (ASO)
The ASO modality is represented primarily through tonlamarsen, an Ionis Pharmaceuticals drug explicitly referenced in a 2024 CN filing from Natide (Qingdao) Biopharmaceutical as being in Phase II clinical trials for hypertension via AGT targeting. Shanghai Argo Biopharmaceutical explicitly combines dsRNA and ASO approaches in a single composition patent, claiming both AGT dsRNA agents and AGT antisense polynucleotide agents as parallel modalities for reducing AGT expression — a strategy that broadens IP coverage across RNA-targeting chemical classes directed at the same transcript.
GalNAc-Conjugated Delivery Systems
GalNAc (N-acetylgalactosamine) conjugation enables hepatocyte-targeted delivery of AGT-silencing siRNA duplexes by exploiting the asialoglycoprotein receptor expressed on liver cells. Patent filings from Natide and Suzhou Shi’an Biotechnology describe siRNA-GalNAc conjugate systems that can maintain prolonged half-life and thereby extend pharmacodynamic duration — directly addressing the long-acting attribute that distinguishes next-generation candidates from the current Phase II benchmark constructs. This delivery approach is consistent with validated GalNAc-siRNA platforms described in published literature from Nature and other peer-reviewed sources.
Explore the full AGT siRNA patent landscape — sequences, assignees, and jurisdictions — in PatSnap Eureka.
Analyse AGT Patents in PatSnap Eureka →Preclinical Evidence: 98% Knockdown and the Compensatory Renin Problem
Alnylam’s EP-granted patent provides the most detailed preclinical dataset in the retrieved corpus: dsRNA targeting AGT knocked down plasma AGT by over 98% in rat models when administered alone or in combination with the ARB valsartan. This level of suppression is consistent with the treatment goals specified in Alnylam’s CN filing, which targets 50–95% suppression of AGT expression at the mRNA and protein level.
Alnylam Pharmaceuticals’ EP-granted patent documents that dsRNA targeting angiotensinogen (AGT) knocked down plasma AGT by over 98% in rat models when administered alone or in combination with the ARB valsartan, with the greatest compensatory renin increase observed in the combination group.
However, the same EP patent documents a critical mechanistic liability: compensatory renin elevation. The greatest renin increase was observed with combination dsRNA plus valsartan — a pharmacologically predictable consequence of RAAS feedback disinhibition. When AGT is depleted, renin — whose substrate has disappeared — is upregulated by the body’s homeostatic response. This is the documented liability that combination strategies will need to address, either through co-administration of renin inhibitors or by demonstrating that renin elevation does not translate into clinically meaningful loss of efficacy.
“None of the standard RAAS interventions — ACE inhibitors, ARBs, renin inhibitors — act at the upstream point that AGT silencing targets. AGT knockdown eliminates substrate availability for the entire cascade.”
A notable adjacent signal comes from the University of California’s CN patent on microRNA inhibitors targeting endothelial dysfunction pathways, including restoration of eNOS coupling activity and maintenance of nitric oxide bioavailability. While not directly AGT-silencing, this filing represents an RNA-level approach to the same disease context — and signals that the RNA-targeting toolkit for hypertension extends beyond the RAAS cascade itself. According to published research indexed by WHO, hypertension affects over one billion people globally, establishing the scale of the addressable market for any durable, infrequently dosed intervention.
Alnylam’s EP patent documents that AGT knockdown — particularly in combination with valsartan — produces the greatest observed increase in renin levels. This compensatory upregulation is a known RAAS feedback response and constitutes a mechanistic liability that next-generation combination strategies (including potential co-administration of renin inhibitors) will need to address for long-acting AGT-silencing agents.
Clinical Signals: Phase II Activity for Tonlamarsen and AD-85481
As of 2024, two nucleic acid drugs targeting AGT were in Phase II clinical trials for hypertension: Alnylam’s siRNA drug (AD-85481) and Ionis Pharmaceuticals’ ASO drug, tonlamarsen — a third-party confirmation sourced from the 2024 CN filing by Natide (Qingdao) Biopharmaceutical. This constitutes the most direct clinical translation signal available in the retrieved patent dataset.
As of 2024, two nucleic acid drugs targeting angiotensinogen (AGT) for hypertension were in Phase II clinical trials: Alnylam Pharmaceuticals’ siRNA drug AD-85481 and Ionis Pharmaceuticals’ antisense oligonucleotide drug tonlamarsen, as confirmed by a third-party patent filing from Natide (Qingdao) Biopharmaceutical Co., Ltd.
The specificity of clinical detail in Alnylam’s JP 2024 filing is notable: it claims administration of approximately 600 mg fixed dose of AD-85481 combined with standard antihypertensives including olmesartan, amlodipine, or indapamide — a level of precision in dose and combination partner that is consistent with clinical trial protocol design rather than early-stage exploration. Multiple Alnylam patent filings reference the ClinicalTrials.gov number NCT01206062 in their background sections, citing published SPRINT and KDIGO studies to establish unmet need — language typically incorporated into IND-enabling and clinical-stage documents. Standards bodies including EMA and the FDA have increasingly engaged with oligonucleotide therapeutics, providing a regulatory pathway framework for this modality class.
The Natide filing also explicitly notes that current marketed antihypertensive drugs require daily dosing and exhibit suboptimal adherence profiles — the core commercial argument for an infrequently dosed subcutaneous nucleic acid therapeutic. The WO 2025 Alnylam filing references concerns about antihypertensive agents’ independent effects on kidney function, consistent with clinical framing that anticipates renal safety endpoints in ongoing studies. No Phase III data, regulatory submissions, or approval decisions are present in the retrieved dataset.
For pregnancy-related hypertension, the CN Alnylam filing and multiple JP filings describe preeclampsia and eclampsia as AGT-associated indications, with specific desired outcomes including maternal blood pressure reduction, reduced maternal proteinuria, increased uteroplacental unit weight, and fetal weight gain — indicating that liver-targeted AGT knockdown can modulate systemic but not placental AGT expression.
Track clinical-stage AGT RNA therapeutics and their patent families in real time with PatSnap Eureka.
Explore AGT Drug Intelligence in PatSnap Eureka →Competitive Landscape: Alnylam’s Patent Fortress and Chinese Challengers
Alnylam Pharmaceuticals holds a dense, multi-jurisdictional patent portfolio on AGT-directed siRNA, with at minimum 15 distinct filings across Brazil, Mexico, Colombia, Peru, EP (Europe), Singapore, Canada, WO (PCT), Taiwan, Japan, Indonesia, and China — representing a systematic global patent prosecution strategy consistent with a commercial-stage IP posture. The compound AD-85481 is explicitly named in combination-therapy claims, the most advanced naming convention observed in the dataset.
Alnylam Pharmaceuticals has filed at minimum 15 distinct AGT siRNA patents across jurisdictions including Brazil, Mexico, Colombia, Peru, Europe (EP), Singapore, Canada, WO (PCT), Taiwan, Japan, Indonesia, and China, claiming specific antisense sequences (SEQ ID NO: 9/10), fixed doses of 50–800 mg, subcutaneous route, and combination-therapy protocols with standard-of-care antihypertensives.
Chinese biopharma is actively filing AGT-silencing patents in parallel. Three distinct Chinese entrants are represented in the dataset: Natide (Qingdao) Biopharmaceutical (siRNA-GalNAc conjugates, 2024 CN), Suzhou Shi’an Biotechnology (siRNA with extended half-life delivery vehicles, 2025 CN), and Shanghai Argo Biopharmaceutical (both dsRNA and ASO modalities, 2024 BR and CL). These filings collectively signal that the Chinese domestic hypertension market — representing a substantial fraction of the global hypertension burden — is a strategic commercial battleground for second-generation AGT nucleic acid drugs, particularly GalNAc-siRNA conjugates positioned on dosing frequency differentiation.
Two additional competitive signals round out the landscape. AdARx Pharmaceuticals (USA) filed a BR patent in 2025 covering compounds and compositions for modulating AGT expression or activity at the mRNA and protein level — representing a US-based challenger with potential differentiating chemistry. Regeneron Pharmaceuticals’ JP 2024 filing targets SLC9A3R2 (a sodium–hydrogen exchanger regulatory protein expressed in kidney) as a hypertension target distinct from RAAS — signalling that genetic-target diversification in resistant hypertension is attracting investment beyond the RAAS cascade. The breadth of assignees now active in this space aligns with the innovation patterns tracked by WIPO in its annual IP statistics reports on nucleic acid therapeutics.
Strategic Implications for Drug Developers and IP Teams
The AGT-silencing patent landscape carries several concrete strategic implications for drug developers, IP counsel, and R&D leaders working in the resistant hypertension space.
Freedom-to-Operate Priorities
Any competitor seeking to develop AGT siRNA therapeutics will need to navigate Alnylam’s dense portfolio. Freedom-to-operate analysis should prioritise the EP granted patent and the WO/CA pending families, which carry the broadest jurisdictional reach. Specific sequence claims (SEQ ID NO: 9/10) and fixed-dose method claims (50–800 mg subcutaneous) are the most constraining IP elements identified in the dataset. Patent databases maintained by the EPO provide the primary resource for tracking the status of these families across European member states.
Label Strategy: Resistant Hypertension as the Highest-Value Claim
Resistant hypertension is the highest-value label claim in this dataset — at least three Alnylam patent families (JP 2025, JP 2023, JP 2022) explicitly define treatment-resistant hypertension as a distinct AGT-associated disorder within their claims, employing the clinically standard three-drug failure criterion with thiazide inclusion. Developers positioning for this label should ensure that clinical trial enrollment criteria align with the regulatory definition and that combination-backbone designs are pre-specified.
Long-Acting Differentiation as the Next Competitive Frontier
Long-acting formulation and adherence are the primary competitive differentiators being claimed in recent 2024–2025 filings from Chinese entrants relative to the Alnylam benchmark. The Suzhou Shi’an filing explicitly develops the rationale that siRNA compositions with specific delivery vectors can achieve extended half-life, converting high-dose constructs into lower-dose, longer-interval regimens. Developers who can demonstrate monthly or quarterly dosing intervals with maintained blood pressure control in resistant hypertension patients will address a documented unmet need explicitly acknowledged in the Alnylam patent background sections themselves. This differentiation thesis is consistent with the broader trajectory of GalNAc-siRNA platforms described in nucleic acid therapeutics literature indexed by PatSnap’s innovation intelligence resources.
Addressing Compensatory Renin Elevation
IP and clinical strategies that address compensatory renin elevation — through co-administration of renin inhibitors or by demonstrating that renin elevation does not limit efficacy — will be important for differentiation of next-generation long-acting AGT-silencing agents. The combination claims in Alnylam’s JP 2024 filing (losartan, valsartan, olmesartan, eprosartan, irbesartan, azilsartan) signal that ARB co-administration is the current preferred approach, but this does not fully resolve the renin feedback loop.
Suzhou Shi’an Biotechnology’s 2025 CN patent explicitly develops the rationale that siRNA compositions with specific delivery vectors can achieve extended half-life and prolonged pharmacodynamic duration, positioning GalNAc-siRNA conjugates as long-acting, lower-dose alternatives to current Phase II benchmark AGT-silencing constructs for resistant hypertension.
The PatSnap platform enables IP teams to monitor these patent families in real time, map freedom-to-operate exposure, and track clinical-stage signals across the nucleic acid therapeutics landscape. With PatSnap’s 2B+ data points across 120+ countries, R&D and IP leaders can build a comprehensive view of the AGT-silencing competitive landscape beyond the snapshot captured in any single patent search.