Three diseases, one critical enzyme: the glyoxylate pathway as a drug target

Primary hyperoxaluria (PH) comprises three molecularly distinct autosomal recessive disorders of hepatic glyoxylate metabolism, all converging on a single enzymatic bottleneck. PH1—caused by mutations in AGXT encoding alanine-glyoxylate aminotransferase—accounts for approximately 80% of PH diagnoses. PH2 arises from deficiency in glyoxylate reductase/hydroxypyruvate reductase (GRHPR), and PH3 from deficiency of mitochondrial 4-hydroxy-2-oxoglutarate aldolase (HOGA1). All three subtypes converge on a final common pathway: lactate dehydrogenase A (LDHA) catalyzes the terminal and rate-limiting conversion of glyoxylate to oxalate in the liver.

This convergence makes LDHA the most strategically important emerging target in the hyperoxaluria pipeline. Unlike lumasiran—which targets glycolate oxidase (HAO1) upstream of LDHA and is therefore restricted to PH1—any agent that suppresses LDHA activity has pan-PH applicability. Lumasiran’s 2020 approval demonstrated that hepatic RNAi is a viable modality in this disease area; the subsequent pipeline has largely organized itself around the question of whether LDHA inhibition can extend those benefits to all three subtypes and, increasingly, to secondary hyperoxaluria arising from metabolic conditions such as diabetes, inflammatory bowel disease, and bariatric surgery.

Four molecular targets are actively pursued across the retrieved dataset: HAO1 (the lumasiran target, now extended to non-PH indications), LDHA (the pan-PH target), PRODH2/proline dehydrogenase 2 (identified in Alnylam patent filings for non-PH oxalate disorders), and the NLRP3/NALP3 inflammasome (a downstream renal inflammatory target identified by researchers at Yale University as a principal driver of progressive renal failure in oxalate nephropathy).

The RNAi landscape beyond lumasiran: nedosiran, combination strategies, and expanded indications

Nedosiran is the most clinically advanced non-lumasiran pipeline asset in the retrieved dataset. Developed by Dicerna Pharmaceuticals (now acquired by Novo Nordisk) and studied extensively at the German Hyperoxaluria Center Cologne/Bonn, nedosiran targets hepatic LDHA via RNAi, providing a rationale for efficacy across PH1, PH2, and PH3 regardless of which upstream enzymatic defect is present. Nonclinical data in mice and non-human primates demonstrated that hepatic LDHA inhibition reduces urinary oxalate excretion with liver-specific effects and no detectable impact on muscle LDHA—a critical safety concern given LDHA’s central role in anaerobic glycolysis. Phase I single-dose data (NCT03847909) confirmed hepatic specificity without off-target muscle effects in humans, and nedosiran has since entered Phase II trials.

Novo Nordisk Health Care AG holds an active JP patent (2025) covering specific LDHA-targeting oligonucleotide sequences, including the antisense strand sequence UCAGAUAAAAAGGACAACAUGG (SEQ ID NO:1), reflecting active IP protection of this approach. Alnylam Pharmaceuticals, the dominant RNAi IP holder for lumasiran, has simultaneously filed patents in WO and JP jurisdictions (2023–2024) extending nucleic acid inhibitor coverage for LDHA, HAO1, and a third target—PRODH2 (proline dehydrogenase 2)—to non-primary hyperoxaluria conditions. These filings explicitly cover patients with diabetes, Crohn’s disease, bariatric surgery sequelae, and other metabolic conditions in which calcium oxalate crystal deposition occurs despite normal primary oxalate metabolism, signalling a strategic shift from ultra-rare to broader metabolic indications.

“Alnylam’s 2023–2024 patent filings explicitly extend LDHA, HAO1, and PRODH2 targeting to secondary hyperoxaluria arising from metabolic conditions—potentially opening a substantially larger patient population than the rare PH diseases.”

A third RNAi strategy has emerged from an academic IP source. Charité – Universitätsmedizin Berlin has filed patents in WO, EP, and US jurisdictions covering a combination of lumasiran and nedosiran as a single therapeutic composition for dialysis patients who do not have primary hyperoxaluria. The clinical rationale is that uremic patients on maintenance dialysis accumulate oxalate, contributing to cardiovascular events and sudden cardiac death. Blocking both the upstream substrate supply (HAO1/glycolate oxidase) and the terminal conversion step (LDHA) simultaneously may achieve additive or synergistic oxalate reduction in this population. No clinical trial data for this combination approach were identified in the retrieved dataset, but the multi-jurisdictional patent filing signals early-mover IP activity in a novel oxalate-cardiovascular indication with a substantially larger addressable population than PH.

HAO1 genetic validation: the human knockout precedent

The human genetic evidence underpinning HAO1 as a drug target is unusually robust. Collaborative work between Bristol Medical School and Alnylam Pharmaceuticals characterized a naturally occurring HAO1 complete-knockout individual—estimated to occur at a frequency of approximately 1 in 30 million—who showed 12-fold elevated plasma glycolate but no adverse systemic consequences. This directly informed the therapeutic rationale for deep and durable HAO1 silencing and established a precedent for using human natural history data to de-risk RNAi target selection. According to WIPO patent databases, HAO1-targeting oligonucleotide IP remains active across multiple jurisdictions. The retrieved dataset notes that similar human genetic validation studies for hepatic LDHA would significantly de-risk the nedosiran and CHK-336 development paths.

CRISPR gene editing and small-molecule inhibitors: one-shot durability versus chronic dosing

CRISPR-Cas9 gene therapy for primary hyperoxaluria is currently at the preclinical stage but offers a mechanistically distinct proposition: a single administration rather than the chronic subcutaneous dosing regimen required by approved RNAi agents. Research from the Instituto de Investigación Sanitaria de Navarra (IdiSNA) demonstrated that a single dose of AAV8-delivered CRISPR-Cas9 targeting hepatic LDH reduced urine oxalate and kidney damage in mouse models of both PH1 and PH3. The authors reference prior work establishing CRISPR-based glycolate oxidase inhibition as a PH1-specific strategy, positioning the LDHA-targeting CRISPR approach as a broader-coverage alternative. No IND filings, Phase I safety data, or human trial references were identified for CRISPR approaches in the retrieved dataset; organ-targeted delivery efficiency and immunogenicity of viral vectors remain key technical barriers.

On the small-molecule front, CHK-336—described by Chinook Therapeutics (Vancouver, Canada) as a first-in-class, liver-targeted, potent, highly selective small-molecule LDH inhibitor—effectively lowers urinary oxalate in a mouse PH1 model with a favorable preclinical pharmacokinetic and safety profile. CHK-336 targets the same LDHA enzyme as nedosiran but employs a small-molecule rather than oligonucleotide modality, which may offer advantages in oral bioavailability and manufacturing scalability. Stanford ChEM-H researchers have also provided a broader systematic analysis of small-molecule enzyme inhibitors across all PH subtypes, covering multiple glyoxylate pathway enzymes. Both CHK-336 and the Stanford-reviewed compounds are at apparent early preclinical or IND-enabling stages based on retrieved evidence.

The competitive dynamic between RNAi and CRISPR for LDHA inhibition mirrors broader industry debates about chronic dosing versus one-shot gene editing. According to patent databases maintained by the European Patent Office, nucleic acid therapeutic filings in rare metabolic diseases have grown substantially since 2019, with LDHA-targeting sequences now subject to active IP protection by Novo Nordisk Health Care AG. The CRISPR approach, if it advances clinically, would compete on the basis of durability and potentially lower long-term cost of goods, while small molecules such as CHK-336 could offer advantages in patient convenience and manufacturing.

Microbiome therapy and substrate reduction: complementary mechanisms at the gut level

Oxalobacter formigenes (Oxabact™, OxThera AB, Stockholm) is an oxalate-metabolizing gut bacterium proposed to mediate active oxalate elimination from plasma to intestine, operating through a mechanism entirely distinct from hepatic substrate reduction. Two registered clinical trials at Phase II/III and Phase III level were identified in the retrieved dataset: a randomized, double-blind, placebo-controlled Phase II/III study conducted at the Academic Medical Center, University of Amsterdam, evaluating Oxabact™ OC3 over 24 weeks in PH patients; and the ePHex Phase III trial at the Royal Free Hospital, London, evaluating Oxabact™ in PH patients with maintained but suboptimal kidney function (mean eGFR less than 90 mL/min/1.73 m²). Primary endpoint outcomes from these trials were not available in the retrieved dataset.

A single-patient case report from the Department of Ophthalmology, University of Bonn documents that O. formigenes combined with intensive dialysis lowered plasma oxalate and halted disease progression in a severely affected infant with PH1, suggesting potential utility even in advanced disease states when combined with other interventions. Retrieved review literature discusses the potential for combining substrate reduction agents (RNAi targeting hepatic oxalate synthesis) with gut-level oxalate disposal (microbiome therapy) as complementary mechanisms addressing both hepatic production and intestinal absorption and excretion.

Substrate reduction via hydroxy-L-proline analogs

A further substrate reduction strategy—distinct from direct enzyme inhibition—involves hydroxy-L-proline (HYP) analogs. HYP is a dietary precursor contributing to hepatic glyoxylate and oxalate production; analogs designed to inhibit its catabolism represent an alternative approach to reducing substrate availability for LDHA. Researchers at Tongji Hospital, Huazhong University of Science and Technology evaluated HYP analogs in a Drosophila melanogaster PH model. This remains at a preclinical invertebrate-model stage with no mammalian or clinical data in the retrieved dataset.

NLRP3 inflammasome inhibition as a renal-protective adjunct

Researchers at Yale University School of Medicine have identified NALP3-mediated renal inflammation as a principal driver of progressive renal failure in oxalate nephropathy. Beta-hydroxybutyrate (BHB) is noted in the dataset as an NLRP3 inhibitor with a preclinical signal in hyperoxaluria-related kidney stone disease. This anti-inflammatory approach is positioned as a complementary strategy to oxalate-reducing agents rather than a standalone therapy, addressing the downstream renal injury that accumulates even when oxalate production is partially controlled. Data on NLRP3 inhibition in this context are referenced by researchers publishing in journals indexed by NIH/PubMed.

Competitive implications: IP whitespace, genetic validation, and the LDHA battleground

LDHA is the central competitive battlefield in the hyperoxaluria pipeline. At least three distinct modalities from multiple organizations converge on this single enzyme, with pan-PH applicability as the key commercial differentiator over lumasiran’s PH1-restricted mechanism. The retrieved patent data from Novo Nordisk Health Care AG protect specific oligonucleotide sequences targeting LDHA, while Alnylam’s filings extend nucleic acid inhibitor coverage to non-PH indications. Competitors entering the LDHA space will face established IP from both Novo Nordisk/Dicerna and, increasingly, from Alnylam’s broader indication claims.

IP whitespace exists in non-PH oxalate-related disorders. Alnylam and Charité filings signal early-mover activity in secondary hyperoxaluria and oxalate-driven cardiovascular disease in dialysis patients—conditions with substantially larger addressable populations than the three primary hyperoxaluria subtypes combined. Organizations entering these indications will encounter established nucleic acid inhibitor IP from Alnylam and potential exclusivity arguments from Charité’s combination therapy claims covering the lumasiran-plus-nedosiran composition.

The precedent set by human HAO1 knockout characterization—demonstrating that complete enzyme loss is benign—represents a model for de-risking future RNAi target selection. Similar human genetic validation for hepatic LDHA loss-of-function would significantly strengthen the safety argument for deep and durable LDHA silencing by nedosiran or CHK-336. Patent landscape analysis tools such as those offered by PatSnap Eureka can accelerate identification of such genetic evidence in the published literature. The PatSnap platform aggregates over 2 billion data points from 120+ countries, enabling systematic IP and literature surveillance across the hyperoxaluria competitive space.

“The clinical positioning of Oxalobacter formigenes relative to RNAi agents—particularly in patients with advanced renal impairment—remains an open strategic question, as primary endpoint outcomes from the ePHex Phase III trial were not available in the retrieved dataset.”

For CRISPR and small-molecule approaches, the absence of any clinical translation signal in the retrieved dataset suggests both remain at early stages. CRISPR/AAV8 approaches face manufacturing and re-dosing challenges alongside immunogenicity concerns for viral vectors—barriers not addressed in the retrieved preclinical results. Small molecules such as CHK-336 may offer a more tractable development path, but will need to demonstrate selectivity for hepatic LDHA over systemic LDHA to address the muscle safety concern that was a primary focus of the nedosiran nonclinical program. As documented by patent offices including the USPTO, the competitive IP landscape in rare metabolic disease RNAi continues to evolve rapidly, making continuous patent surveillance a strategic necessity for any organization active in this space.